missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ BLOCK-iT™ Lentiviral RNAi Gateway™ Vector Kit

Product Code. 10063192
Change view
Click to view available options
Quantity:
20 Reactions
Unit Size:
Each
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Product Code. Quantity unitSize
10063192 20 Reactions Each
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
This item is not returnable. View return policy

For Research Use Only. All usage must comply with product instructions.

Product Code. 10063192 Supplier Invitrogen™ Supplier No. K494300

Please to purchase this item. Need a web account? Register with us today!

This item is not returnable. View return policy

For Research Use Only. All usage must comply with product instructions.

Includes

The BLOCK-iT™ Lentiviral RNAi Gateway™ Vector Kit contains the pLenti6/BLOCK-iT™-DEST vector, pLenti6-GW/U6-laminshRNA control vector, and One Shot™ Stbl3 Competent Cells. Vectors are supplied supercoiled and lyophilized. The BLOCK-iT™ Lentiviral RNAi Expression System contains the BLOCK-iT™ Lentiviral RNAi Gateway™ Vector Kit, BLOCK-iT™ U6 Entry Vector Kit, ViraPower™ Bsd Support Kit, 293FT Cell Line, and LR Clonase™ enzyme mix.

The pLenti6/BLOCK-iT-DEST expression vector provided in the BLOCK-iT Lentiviral RNAi Expression System can be used to efficiently introduce and stably express short hairpin RNA (shRNA) in vivo from a lentiviral vector

A novel cloning process places an approx. 50-bp DNA oligonucleotide immediately following a U6 pol III promoter into the BLOCK-iT U6 entry vector. The oligonucleotide is designed to express RNA that forms a stemLoop structure containing the sense and antisense regions of your target gene of interest. This shRNA is then recombined into the pLenti6/BLOCK-iT-DEST vector. After viral production and transduction, the shRNA driven by the U6 promoter becomes stably integrated as an RNAi cassette. The shRNA generated avoids the hosts defense mechanism and will be effective at producing the RNAi gene knockdown response. Using the BLOCK-iT Lentiviral RNAi Expression System, long-term analysis of gene blocking in both dividing and non-dividing mammalian cell types and animal models can be achieved.

The BLOCK-iT RNAi U6 Entry Vector Kit allows streamlined cloning of shRNA target sequences for testing in transient experiments. Selected RNAi expression cassettes are quickly and efficiently recombined from the BLOCK-iT RNAi U6 entry vector into the pLenti6/BLOCK-iT-DEST vector via a standard Gateway LR recombination reaction.

  • attR sites for efficient recombination with the attL-flanked U6 Gateway™ entry vector containing the RNAi cassette
  • All of the required components for efficient lentiviral packaging and delivery of the shRNA of interest
  • Blasticidin selection marker for fast, efficient selection of stable cell lines expressing the shRNA

Cloning, Gateway Cloning, Lentiviral shRNA and miRNA, RNAi, RNAi, Epigenetics and Non-Coding RNA Research, Virus-Based RNAi

TRUSTED_SUSTAINABILITY

Specifications

Product Type RNAi Expression Vector Kit
Content And Storage The BLOCK-iT™ Lentiviral RNAi Gateway™ Vector Kit contains the pLenti6/BLOCK-iT™-DEST vector, pLenti6-GW/U6-laminshRNA control vector, and One Shot¤ Stbl3 Competent Cells. Vectors are supplied supercoiled and lyophilized. Store at -20°C once resuspended. Store Competent Cells at -80°C. The BLOCK-iT™ Lentiviral RNAi Expression System contains the BLOCK-iT™ Lentiviral RNAi Gateway™ Vector Kit, BLOCK-iT™ U6 Entry Vector Kit, ViraPower™ Bsd Support Kit, 293FT Cell Line, and LR Clonase™ enzyme mix. Store components as indicated in the respective kits. Store the LR Clonase™ mix at -80°C. Guaranteed stable for 6 months when properly stored.
Cloning Method Gateway™
Constitutive or Inducible System Constitutive
Delivery Type Lentiviral
RNAi Type shRNA
Selection Agent (Eukaryotic) Blasticidin
Vector pLenti
Promoter U6
Format Kit
Product Line BLOCK-iT, Gateway
Quantity 20 Reactions
Show More Show Less
Can I use any Gateway entry vector to generate entry clones for use in RNAi applications?

No, you should use an entry vector that contains the elements necessary for RNA Polymerase III-dependent expression of your shRNA (i.e., Pol III promoter and terminator).

What is a dose response curve or kill curve? And can you outline the steps involved?

A dose response curve or kill curve is a simple method for determining the optimal antibiotic concentration to use when establishing a stable cell line. Untransfected cells are grown in a medium containing antibiotic at varying concentrations in order to determine the lowest amount of antibiotic needed to achieve complete cell death. The basic steps for performing a dose response curve or kill curve are as follows:

- Plate untransfected cells at 25% confluence, and grow them in a medium containing increasing concentrations of the antibiotic. For some antibiotics, you will need to calculate the amount of active drug to control for lot variation.
- Replenish the selective medium every 3-4 days. After 10-12 days, examine the dishes for viable cells. The cells may divide once or twice in the selective medium before cell death begins to occur.
- Look for the minimum concentration of antibiotic that resulted in complete cell death. This is the optimal antibiotic concentration to use for stable selection.

Can I create stable cell lines using pENTR/U6 entry vector or the pENTR/H1/TO vector?

Unfortunately, the pENTR/U6 vector does not contain a selection marker; therefore, only transient RNAi analysis may be performed. If you wish to generate stable cell lines, perform an LR reaction into an appropriate Gateway destination vector to generate expression clones.
The pENTR/H1/TO vector contains the Zeocin resistance gene to facilitate generation of cell lines that inducbily express the shRNA of interest. Perform a kill curve to determine the minimum concentration of Zeocin that is required to kill your untransfected mammalian cell line. Please note that Zeocin-sensitive cells do not round up and detach from the plate, but rather may increase in size, show abnormal cell shape, display presence of large empty vesicles in the cytoplasm, or show breakdown of plasma/nuclear membranes.

What loop sequence should I use when designing my shRNA for cloning? Do you have any guidelines I should follow?

You can use a loop sequence of any length ranging from 4 to 11 nucleotides, although short loops (i.e., 4-7 nucleotides) are generally preferred. Avoid using a loop sequence containing thymidines (Ts), as they may cause early termination. This is particularly true if the target sequence itself ends in one or more T nucleotides. Here are some loop sequences we recommend:

- 5' - CGAA - 3'
- 5' - AACG - 3'
- 5' - GAGA - 3'

What considerations regarding transcription initiation should I take when designing my shRNA for cloning?

Transcription of the shRNA initiates at the first base following the end of the U6 promoter sequence. In the top-strand oligo, the transcription initiation site corresponds to the first nucleotide following the 4 bp CACC sequence added to permit directional cloning. We recommend initiating the shRNA sequence at a guanosine (G) because transcription of the native U6 snRNA initiates at a G. Note the following:

- If G is part of the target sequence, then incorporate the G into the stem sequence in the top-strand oligo and add a complementary C to the 3' end of the top-strand oligo.
- If G is not the first base of the target sequence, we recommend adding a G to the 5' end of the top-strand oligo directly following the CACC overhang sequence. In this case, do not add the complementary C to the 3' end of the top-strand oligo. Note: We have found that adding the complementary C in this situation can result in reduced activity of the shRNA. Alternative, if use of a G to initiate transcription is not desired, use an adenosine (A) rather than C or T. Note, however, that use of any nucleotide other than G may affect initiation efficiency and position.

How do I order the shRNA for vector expression?

Please follow the steps outlined below:

- Visit RNAi Designer
- Enter an accession number or provide a nucleotide sequence
- Determine the region for target design: ORF, 5' UTR, or 3' UTR
- Choose database for Blast
- Choose minimum and maximum G/C percentage
Select vector and strand orientation and click “RNAi Design” to design shRNA.

What molar ratio do you recommend for ligating my ds oligo to the pENTR/U6 entry vector or pENTR/H1/TO vector?

For optimal results, use a 10:1 molar ratio of ds oligo insert:vector for ligation.

How can I check the integrity of my ds oligo once it is annealed?

We suggest running an aliquot of the annealed ds oligo (5 µL of the 500 nM stock) and comparing it to an aliquot of each starting single-stranded oligo (dilute the 200 µM stock 400-fold to 500 nM; use 5 µL for gel analysis). Be sure to include an appropriate molecular weight standard. We generally use the following gel and molecular weight standard:

- Agarose gel: 4% E-Gel (Cat. No. G5000-04)
- Molecular weight standard: 10 bp DNA Ladder (Cat. No. 10821-015)

When analyzing an aliquot of the annealed ds oligo reaction by agarose gel electrophoresis, we generally see the following:
- A detectable higher molecular weight band representing annealed ds oligo.
- A detectable lower molecular weight band representing unannealed single-stranded oligos. Note that this band is detected since a significant amount of the single-stranded oligo remains unannealed.

How do I anneal my single-stranded DNA oligos to create a ds oligo?

You will want to anneal equal amounts of the top- and bottom-strand oligos to generate the ds oligos. If your single-stranded oligos are supplied lyophilized, resuspend them in water or TE buffer to a final concentration of 200 µM before use. We generally perform the annealing reaction at a final single-stranded oligo concentration of 50 µM. Annealing at concentrations lower than 50 µM can significantly reduce the efficiency. Note that the annealing step is not 100% efficient; approximately half of the single-stranded oligos remain unannealed even at a concentration of 50 µM. Please see the steps below:

1. In a 0.5 mL sterile microcentrifuge tube, set up the following annealing reaction at room temperature.
“Top-strand” DNA oligo (200 µM) - 5 µL, “Bottom-strand” DNA oligo (200 µM)- 5 µL, 10X Oligo Annealing Buffer - 2 µL, DNase/RNase-Free Water - 8 µL which should make a total volume of 20 µL.
2. If reannealing the lacZ ds control oligo, centrifuge its tube briefly (approximately 5 seconds), then transfer the contents to a separate 0.5 mL sterile microcentrifuge tube.
3. Incubate the reaction at 95 degrees C for 4 minutes.
4. Remove the tube containing the annealing reaction from the water bath or the heat block, and set it on your laboratory bench.
5. Allow the reaction mixture to cool to room temperature for 5-10 minutes. The single-stranded oligos will anneal during this time.
6. Place the sample in a microcentrifuge and centrifuge briefly (approximately 5 seconds). Mix gently.
7. Remove 1 µL of the annealing mixture and dilute the ds oligo as directed.
8. Store the remainder of the 50 µM ds oligo mixture at -20 degrees C.
You can verify the integrity of your annealed ds oligo by agarose gel electrophoresis, if desired.

What do I need to order to use your pENTR/U6 entry vector or pENTR/H1/TO vector?

You will need a double-stranded oligo that encodes the shRNA of interest to be cloned into one of the above-mentioned vectors. Use our RNAi Designer to design and synthesize two complementary single-stranded DNA oligonucleotides, with one encoding the shRNA of interest.

What does TO stand for in the pENTR/H1/TO vector?

TO stands for tetracycline operator, as this entry vector contains elements required for tetracycline-inducible expression of the shRNA in mammalian cells. The presence of the Tet operator sequences enables the shRNA of interest to be expressed in a tetracycline-dependent manner, thereby making this an inducible system.

What is the difference between the H1 and the U6 promoters?

The BLOCK-iT Inducible H1 and U6 Entry Vector Kits use either the Pol III-dependent H1 or the U6 promoter, respectively. The H1 promoter is modified to contain two flanking tetracycline operator (TetO2) sites within the H1 promoter. This allows the shRNA expressed from this promoter to be regulated in cells that express the tetracycline repressor (TR) protein. Both the H1 and the U6 are Pol III type promoters; however, there may be some minor differences in their effectiveness, depending on the cell line used.

What vectors do you offer for shRNA?

We offer our pENTR/U6 (Cat. No. K494500) and pENTR/H1/TO (Cat. No. K492000) vectors for shRNA delivery. Both vectors are Gateway compatible and drive expression through either the U6 or H1/TO promoter, respectively. The pENTR/H1/TO vector is for inducible shRNA expression, while the pENTR/U6 can be used for constitutive expression. If you want to design shRNA oligos compatible with both vectors, select the pENTER/U6 vector.

What are the general features of shRNA?

Exogenous short hairpin RNAs can be transcribed by RNA Polymerase III (Paule and White, 2000) and generally contain the following structural features: A short nucleotide sequence ranging from 19-29 nucleotides derived from the target gene, followed by a short spacer of 4-15 nucleotides (i.e., loop) and a 19-29 nucleotide sequence that is the reverse complement of the initial target sequence. The resulting RNA molecule forms an intramolecular stem-loop structure that is then processed to an siRNA duplex by the Dicer enzyme.

What does shRNA stand for, and how does it work?

Short hairpin RNA (shRNA) is an artificially designed class of RNA molecules that can trigger gene silencing through interaction with cellular components common to the RNAi and miRNA pathways. Although shRNA is a structurally simplified form of miRNA, these RNA molecules behave similarly to siRNA in that they trigger the RNAi response by inducing cleavage and degradation of target transcripts (Brummelkamp et al., 2002; Paddison et al., 2002; Paul et al., 2002; Sui et al., 2002; Yu et al., 2002). An RNA Polymerase III (Pol III), such as U6 and H1, drives transcription of shRNA transcripts. shRNA hairpins are exported from the nucleus and processed by Dicer into the cytosol, resulting in siRNA.

Why is a Pol III type promoter used for BLOCK-iT shRNA?

For efficient shRNA expression, a Pol III type promoter is used. These Pol III promoters contain all of their essential elements upstream of the expressed RNA and terminate with a short polythymidine tract. Once the shRNA is expressed, it is transported from the nucleus and processed into siRNA in the cytoplasm by the enzyme Dicer. Dicer preferentially recognizes shRNAs generated from a Pol III promoter because they carry no 5' or 3' flanking sequences. The siRNAs enter into RISC complexes and generate an RNAi response in mammalian cells.

Can I perform the single-step protocol for the BP/LR Clonase reaction using BP Clonase enzyme and LR Clonase enzyme instead of BP Clonase II enzyme and LR Clonase II enzyme?

In the single-step protocol for the BP/LR Clonase reaction, we would not recommend substituting the BP Clonase II/LR Clonase II enzymes with BP Clonase /LR Clonase enzymes as this would result in very low recombination efficiency.

Do you have a recommended single-step protocol for BP/LR recombination?

Yes, we have come up with a single-step protocol for BP/LR Clonase reaction (http://www.thermofisher.com/us/en/home/life-science/cloning/gateway-cloning.html#1), where DNA fragments can be cloned into Destination vectors in a single step reaction, allowing you to save time and money.

How can I move my gene of interest from a Gateway-adapted expression clone to a new Destination vector as I have lost the entry clone?

We would recommend performing a BP reaction with a Donor vector in order to obtain an entry clone. This entry clone can then be used in an LR reaction with the Destination vector to obtain the new expression clone.

Can I purchase the 5X LR Clonase buffer or 5X BP Clonase buffer separately?

We do not offer the 5X LR Clonase buffer and 5X BP Clonase buffer as standalone products. They are available as part of the enzyme kits.

Do you offer Gateway vectors for expression in plants?

We do not offer any Gateway vectors for expression in plants.

How large of a PCR product can I recombine with a pDONR vector via BP cloning? Does the same apply for TOPO-adapted Entry vectors?

There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.

How should I clean up my attB-PCR product?

After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.

I'm trying to propagate my Gateway destination vector and am not seeing any colonies. What should I do?

Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.

What is the difference between LR Clonase II and LR Clonase II Plus?

LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.

How do the BLOCK-iT shRNA products compare to the BLOCK-iT miR RNAi system?

Both systems are used for gene targeting or gene knockdown but each has distinctive features. The shRNA expression vectors like pENTR/U6 or pENTR/H1-TO use Pol III promoters, whereas the miRNA expression vectors are flexible to use more common and more processive Pol II promoters like CMV, EF1 or other mammalian expression promoters. You can only clone a single shRNA sequence into an shRNA vector to target a single gene, whereas multiple miRNA sequences can be cloned together into an miRNA vector to target one or more genes, or multiple locations in a gene. An additional feature of the miRNA expression vectors is that, due to use of Pol II promoters, the miRNA can be expressed directly in fusion with a reporter gene like EmGFP to monitor transfection and transcription.

What is the purpose of the Proteinase K step following a Gateway LR Recombination reaction, and is it critical to the results?

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Once I make lentivirus, can I amplify the virus or do I need to do another transfection?

The lentiviruses produced in this system will not replicate under any conditions. You must perform a fresh transfection each time you need more virus.

Can the pLenti6/D-TOPO vector be used by itself as an expression vector (without packaging mix)?

Yes, it will work as an expression vector by itself and can be stably selected with blasticidin. Please note that the vector will be about twice the size of most regular vectors. Therefore you may need to increase the amount of transfected vector to approximate molar equivalents.

Does the lentivirus produce any toxic viral genes?

Lentiviruses produced with this system do not carry or express ANY viral genes and therefore have no associated toxicity issues. Only the protein expressed from the coding region between the LTR sites is incorporated into the mammalian cell chromosome and expressed. The lentivirus itself cannot replicate because of the built-in safety features.

Why are 293FT cells cultured under Geneticin selection before transfection?

For routine maintenance of 293FT cells, you need to add Geneticin (G418) antibiotic at a concentration of 500 µg/mL to maintain the Large T antigen plasmid/phenotype.

What does the FT stand for in 293FT and why is this the most recommended producer cell line?

The F stands for the high transfection efficiency of this particular 293 cell clone (called 293F) and the T stands for the SV40 large T antigen. If you want to use regular 293 cells or another 293T cell line, you will be able to produce virus, but the titers will be lower. The large T antigen expression plasmid is stably integrated in the 293FT cell and confers resistance to Geneticin antibiotic in these cells.

How much blasticidin do you usually put into culture medium to select for blasticidin-resistant clones for virus titration (HT1080 cells)?

For HT1080 cells we typically use 10 µg/mL, but we strongly recommend that you generate a kill-curve for each antibiotic and cell line before proceeding. Most cell types respond to between 1 µg/mL and 10 µg/mL of blasticidin. For HT1080 cells, we typically use 100 µg/mL of Zeocin for Zeocin-containing lentiviral vectors. But again, generation of a kill-curve is strongly suggested.

We strongly recommend titering on HT1080 cells to determine the absolute titer of infectious virus in your supernatant. The primary reason is that it's a way to standardize titers obtained in different labs. Transduction efficiency is high in these cells, and titering results are very accurate and reproducible, making HT1080 cells the gold standard for titering. You can then try different MOIs in other cell types based on HT1080 titers. For instance, you may require an MOI of 50 in one cell type or MOI of 10 in another cell type based on titers obtained in HT1080.Accurate titer, however, can be obtained in essentially any mammalian cell line, but 3T3 and HeLa cells have a lower transduction efficiency than HT1080 cells (for reasons unknown). Do not use 293FT cells for titering.

Can I remove the CMV promoter from the pLenti6/V5-D-TOPO or pLenti6/V5-DEST vectors?

Yes, you can use restriction enzymes Cla I (cutting at 1796) and BamH I (cutting at 2401) to remove the CMV promoter from the pLent6/V5-D-TOPO vector. Use Cla I and Spe I for the pLenti6/V5-DEST vector. Alternatively, we offer promoter-less lentiviral vector, pLenti6.4/R4R2/V5-DEST (Cat. No. A11145).

How do I concentrate the lentiviral stock?

Ultracentrifugation is the most commonly used approach and is typically very successful (see Burns et al. (1993) Proc Natl Acad Sci USA 90:8033-8037; Reiser (2000) Gene Ther 7:910-913). Others have used PEG precipitation. Some purification methods are covered by patents issued to the University of California and Chiron.

Adenovirus is concentrated using CsCl density gradient centrifugation (there is a reference for this procedure in our adenovirus manual) or commercially available columns.

What titers are typical with lentivirus?

Titers between 1 x 10e5 and 3 x 10e5 cfu/mL (unconcentrated) are typical. If the titer is lower than 1x 10e5 cfu/mL, virus production was not optimal (arising for various reasons). Titers for the LacZ virus are typically in this low to mid 10e5 range. The sample lentiviral titer experiment shown in the ViraPower instruction manual shows lacZ lentivirus with a titer of 4.8 x 10e6 cfu/mL.

We strongly suggest that you titer your lentivirus on HT1080 cells, which allows you to compare titers from day-to-day within your lab and also with external labs. Transduction efficiency is high in these cells, and titering results are very accurate and reproducible--making HT1080 cells the gold standard for titering. You can then try different MOIs in other cell types based on HT1080 titers. For instance, you may require an MOI of 50 in one cell type or MOI of 10 in another cell type based on titers obtained in HT1080.

What are the advantages of the lentiviral system?

The ViraPower Lentiviral System:
(1) effectively transduces both dividing and non-dividing cells
(2) efficiently delivers the gene of interest to mammalian cells in culture or in vivo
(3) produces a pseudotyped virus with a broadened host range
(4) includes multiple features designed to enhance the biosafety of the system

How does the lentiviral system work? How do I make the lentivirus?

Clone your gene of interest into one of our lentiviral expression vectors. We have a Directional TOPO version (pLenti6/V5/D-TOPO) and a Gateway version (pLenti6/V5-DEST vector). Co-transfect your recombinant vector along with the optimized ViraPower packaging mix into the 293FT producer cell line using Lipofectamine 2000 reagent (if using a different transfection reagent, follow the manufacturer's recommendations). Harvest the viral supernatant and determine the titer of the virus. Add the viral supernatant to your mammalian cell line of interest at the appropriate MOI. Assay for "transient" expression of your recombinant protein or select for stably transduced cells using the appropriate selection antibiotic, if desired, then examine expression of your protein of interest.

Will I get the same transduction efficiency with both lentivirus and adenovirus in the same cell line?

This depends entirely on the target cell. Adenovirus requires the coxsackie-adenovirus receptor (CAR) and an integrin for efficient transduction. Lentivirus (with VSV-G) binds to a lipid in the plasma membrane (present on all cell types). With two totally different mechanisms of entry into the cell, there will always be differences in transduction efficiencies. However, the efficiency of transduction for both viral systems is easily modulated by the multiplicity of infection (MOI) used.

Do you recommend a specific FBS for culture of the 293FT or 293A cells used in the ViraPower kits? What plastic plates do you recommend?

We use mycoplasma-tested Gibco FBS (Cat. No. 16000-044) without any modifications. We have observed that when 293FT cells are cultured in the presence of this FBS following the instructions in the manual, virus production is better than that obtained with many other serum sources.

We use the following plasticware for 293A and 293FT cells:

T175--Fisher Cat. No. 10-126-13; this is a Falcon flask with 0.2 µm vented plug seal cap.

T75--Fisher Cat. No. 07-200-68; this is a Costar flask with 0.2 µm vented seal cap.

100 mm plate--Fisher Cat. No. 08-772E; this is a Falcon tissue culture-treated polystyrene plate

We get excellent adherence on these plates under routine cell culture/maintenance conditions (expect cell lysis in 293A cells when making adenovirus).

How should I store lentivirus, adenovirus and viral vectors?

Viral vectors:
Store lentiviral and adenoviral expression vectors (plasmid DNA) at -20 degrees C. Due to their relatively large sizes, we do not recommend storing these vectors at -80 degrees C, as the vector solutions will completely freeze and too many freeze thaws from -80 degrees C will affect the cloning efficiency. At -20 degrees C, the vectors will be stable but will not freeze completely. Glycerol stocks of vectors transformed into bacteria should always be stored at -80 degrees C.

Virus:
Both adenovirus and lentivirus particles should be aliquoted immediately after production and stored at -80 degrees C.

Lentivirus is more sensitive to storage temperature and to freeze/thaw than adenovirus and should be handled with care. Adenovirus can typically be frozen/thawed up to 3 times without loss of titer, while lentivirus can lose up to 5% or more activity with each freeze/thaw. It is recommended to aliquot your virus into small working volumes immediately after production, freeze at -80 degrees C, and then thaw just one aliquot for titering. This way, every time you thaw a new aliquot it should be the same titer as your first tube.

Adenovirus particles can be kept overnight at 4 degrees C if necessary, but it is best to avoid this. Viruses will be most stable at -80 degrees C.

When stored properly, viral stocks should maintain consistent titer and be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.

What are the safety issues associated with the use of your viral systems?

Both the lentiviral and adenoviral systems should be used following Biosafety Level 2 (BSL-2). We recommend strict adherence to all CDC guidelines for BSL-2 (as well as institutional guidelines). Thermo Fisher Scientific has also engineered specific safety features into the lentiviral system.

Consult the "Biosafety in Microbiological and Biomedical Laboratories" publication (www.cdc.gov, published by the CDC in the USA, describes BSL-2 handling) and the "Laboratory Biosafety Guidelines" publication (www.phac-aspc.gc.ca, published by the Centre for Emergency Preparedness and Response in Canada) for more information on safe handling of various organisms and the physical requirements for facilities that work with them.

How do I know whether to choose lentivirus or adenovirus for viral expression?

If you're interested in stable integration and selection, choose the lentiviral system. We offer both a Directional TOPO (D-TOPO) and Gateway version of the kit to provide flexibility in the cloning of the gene of interest.

If you're looking for transient gene expression, choose the adenoviral system. We offer the Gateway cloning method for this product. It should be noted, however, that gene expression from both systems is typically detected within 24-48 hours of transduction, so both systems can be used for experiments of a transient nature. The main difference is that lentivirus integrates into the host genome and adenovirus does not. Higher viral titers are achieved with the adenovirus.

What are the packaging limits for lentivirus and adenovirus? Can a 9 kb fragment be packaged into either?

No, neither lentivirus nor adenovirus can take an insert as large as 9 Kb. Lentiviral packaging limits are around 6 kb and adenoviral packaging limits are around 7-7.5 kb. Above that, no virus is made.

For lentivirus, titers will generally decrease as the size of the insert increases. We have effectively packaged inserts of 5.2 kb with good titer (approx. 0.5 x 10^5 cfu/mL). The size of the wild-type HIV-1 genome is approximately 10 kb. Since the size of the elements required for expression from pLenti vectors add up to approximately 4-4.4 kb, the size of your gene of interest should theoretically not exceed 5.6-6 kb for efficient packaging (see below for packaging limits for individual vectors).
pLenti4/V5-DEST vector: 6 kb
pLenti6/V5-DEST vector: 6 kb
pLenti6/V5/D-TOPO vector: 6 kb
pLenti6/UbC/V5-DEST vector: 5.6 kb

For adenovirus, the maximum packagable size is approximately 7-7.5 Kb (see below for packaging limits for individual vectors).
pAd/CMV/V5-DEST vector: 6 kb
pAd/PL-DEST vector: 7.5 kb

Can I go directly from a pENTR/D-TOPO reaction into an LR Clonase Reaction without first purifying the DNA?

In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:

1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.

When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.

Can N-terminal or C-terminal tags be attached to a Gateway Entry clone?

To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.

To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.

Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.

Can an attB-PCR product be cloned directly into an expression (Gateway Destination) vector?

No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".

Can Gateway technology be used to express two proteins from the same vector?

Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.

What is the efficiency of recombination in the Gateway system?

For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.

Are there common restriction sites that can be used to excise a gene out of a Gateway plasmid?

The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.

If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.

Do you have recommended sequencing primers for pDONR201?

We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Can you please list some references for Gateway Cloning Technology?

1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.

2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.

3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).

4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306

5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.

6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.

7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.

8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.

9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.

10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).

11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).

12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.

13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.

14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435

15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination

16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)

17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs

18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).

19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.

20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).

21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.

How large can PCR fragments be and still be cloned into a Gateway Entry vector?

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Where can I get Gateway vector sequences and maps?

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

From where does Gateway get its lambda nomenclature, and is it consistent with textbook nomenclature for lambda recombination?

The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

What is the first step in an experiment with the Gateway system?

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.

What are the prerequisites for Gateway cloning and expression?

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Will increasing the Gateway cloning reaction time improve recombination efficiency?

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

How many times can I thaw BP Clonase II and LR Clonase II?

BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.

How clean must my DNA be to use in a Gateway cloning reaction?

Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.

How would you incorporate a leader sequence for secretion into an entry vector?

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Where is the ATG relative to the 5' attB site in a Gateway expression clone?

This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Are the Gateway attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Will Gateway att sites affect the expression of my protein?

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Can the attB primers anneal in a non-specific manner?

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

What is the smallest fragment that can be used in a Gateway reaction?

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Are there any limitations on the insert length in Gateway cloning?

There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.

What primer purity should be used for adding attB sites to my PCR product?

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

I'm getting no fluorescence signal with my expression clone containing EmGFP. What should I do?

Please ensure that the recommended filter sets for detection of fluorescence are used. Use an inverted fluorescence microscope for analysis. If desired, allow the protein expression to continue for 1-3 days before assaying for fluorescence.

I'm seeing nonspecific, off-target gene knockdown. What should I do?

The target sequence used may contain strong homology to other genes; please select a different target region.

I am not getting any colonies after titering. What would suggest I try?

Perform a kill curve to determine the antibiotic sensitivity of your cell line. Ensure that viral stocks are stored properly at -80 degrees C, and do not undergo freeze/thaw more than 3 times. Lastly, transducer the lentiviral contruct into cells in the presence of Polybrene reagent.

I'm getting few or no colonies, even with the transformation control. What could be the cause of this?

Ensure that the competent cells used were stored properly at -80 degrees C, and thawed on ice for immediate use. When adding DNA, mix competent cells gently: do not mix by pipetting up and down. Also do not exceed the maximum recommended amount of DNA for transformation (100 ng) or allow the volume of DNA added to exceed 10% of the volume of the competent cells, as these may inhibit the transformation.

I'm seeing some basal expression of my shRNA of interest in the absence of tetracycline induction when using the BLOCK-iT H1 construct or pLenti4/BLOCK-iT-DEST construct. What could be causing this?

Please check to ensure that your medium containing fetal bovine serum (FBS) is reduced in tetracycline. Many lots of FBS contain tetracycline, as FBS is often isolated from cows that have been fed a diet containing tetracycline, leading to low basal expression of shRNA. Ensure that a cell line expressing the Tet repressor is being used, and that the cells used are transduced at a suitable MOI. If creating your own Tet repressor-expressing cell line, wait at least 24 hours before transducing cells with your shRNA construct.

I'm seeing a low level of gene knockdown or no gene knockdown. What can you suggest I try?

Low expression levels can be due to several factors. Please see the suggestions below:

- Low transfection efficiency: ensure that antibiotics are not added to the media during transfection, and that cells are at the proper cell confluency; optimize transfection conditions by varying the amount of transfection reagent used.
- Try a time course assay to determine the point at which the highest degree of gene knockdown occurs.
- Mutations are present in your construct: analyze the transformants by sequencing the ds oligo insert to verify its sequence.
- Target region is not optimal: select a different target region.
- Ensure siRNA is designed according to guidelines listed in the respective manual.

I'm seeing cytotoxic effects after transfection of my shRNA/miRNA construct. What is causing this?

You can try to scale back the amount of transfection reagent used, or use a different reagent for the transfection. Additionally, ensure that the plasmid used is pure and properly prepared for transfection.

I'm having difficulty sequencing the ds oligo insert in my shRNA construct. What is causing this, and do you have any suggestions on how to improve my sequencing results?

Difficulties sequencing could occur because the hairpin sequence is an inverted repeat that can form secondary structure during sequencing, resulting in a drop in the sequencing signal when entering the hairpin. If you encounter difficulties while sequencing, please try the following:

- Use high-quality, purified plasmid DNA for sequencing. We recommend preparing DNA using the Invitrogen PureLink HQ Mini Plasmid Purification Kit (Cat. No. K2100-01) or S.N.A.P. Plasmid DNA MidiPrep Kit (Cat. No. K1910-01).
- Add DMSO to the sequencing reaction to a final concentration of 5%.
- Increase the amount of template used in the reaction (up to twice the normal concentration).
- Standard sequencing kits typically use dITP in place of dGTP to reduce G:C compression. Other kits containing dGTP are available for sequencing G-rich and GT-rich templates. If you are using a standard commercial sequencing kit containing dITP, obtain a sequencing kit containing dGTP (e.g., dGTP BigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit, Cat. No. 4390229) and use a 7:1 molar ratio of dITP:dGTP in your sequencing reaction.

I'm trying to create my entry clone but am seeing mutated inserts. What should I do?

We highly recommend sequencing positive transformants to confirm the sequence of the ds oligo insert. When screening transformants, we find that up to 20% of the clones may contain mutated inserts (generally 1 or 2 bp deletions within the ds oligo). The reason for this is not known, but may be due to triggering of repair mechanisms within E. coli as a result of the inverted repeat sequence within the ds oligo insert. Note: Entry clones containing mutated ds oligo inserts generally elicit a poor RNAi response in mammalian cells. Identify entry clones with the correct ds oligo sequence and use these clones for your RNAi analysis.
Mutated inserts could also be caused by using poor-quality single-stranded oligos. Use mass spectrometry to check for peaks of the wrong mass, or order HPLC- or PAGE-purified oligos to avoid this problem.

I'm trying to anneal my oligos to create a ds oligo for ligation into one of your shRNA or miRNA RNAi vectors. When I run my ligated ds oligo on an agarose gel, I do not see any bands representing the ds oligo. What could be happening?

- Verify that the sequence of the bottom-strand oligo is complementary to the sequence of the top-strand oligo.
- For the shRNA vectors, make sure that you mix single-stranded oligos with complementary sequences. The top-strand oligo should include CACC on the 5' end, while the bottom-strand oligo should include AAAA on the 5' end.
- For the miRNA vectors, make sure that the top-strand oligo includes TGCT at the 5' end and that the bottom-strand oligo includes CCTG at the 5' end.

I'm trying to anneal my oligos to create a ds oligo for ligation into one of your shRNA or miRNA RNAi vectors. When I run my ligated ds oligo on an agarose gel, the bands are weak. What could be happening?

Please review the possibilities below:

- Single-stranded oligos designed incorrectly; verify that the sequence of the bottom-strand oligo is complementary to the sequence of the top strand oligo.
- Ensure that oligos are annealed at room temp for 5-10 minutes after heating to 95 degrees C.
- Check the molar ratio you are using for annealing top and bottom-strand oligo; equal amounts should be used.

When performing RNAi knockdown studies with your lentiviral constructs, when should I start seeing inhibition of gene expression?

When performing RNAi studies using pLenti4/BLOCK-iT-DEST lentiviral constructs, we generally observe significant inhibition of gene expression within 48-120 hours after transduction. The degree of gene knockdown depends on the time of assay, stability of the protein of interest, and on the other factors. Note that 100% gene knockdown is generally not observed, but >80% is possible with optimized conditions.

What are the safety features of the BLOCK-iT Lentiviral RNAi Expression System?

The lentiviral and packaging vectors supplied in the BLOCK-iT Lentiviral RNAi Expression System are third-generation vectors based on lentiviral vectors developed by Dull et al., 1998. This third-generation lentiviral system includes a significant number of safety features designed to enhance its biosafety and to minimize its relation to the wild-type human HIV-1 virus. The BLOCK-iT Lentiviral RNAi Expression System includes the following key safety features:

- The pLenti6/BLOCK-iT-DEST expression vector contains a deletion in the 3' LTR (?U3) that does not affect generation of the viral genome in the producer cell line, but results in “self-inactivation” of the lentivirus after transduction of the target cell (Yee et al., 1987; Yu et al., 1986; Zufferey et al., 1998). Once integrated into the transduced target cell, the lentiviral genome is no longer capable of producing packageable viral genome.
- The number of genes from HIV-1 that are used in the system has been reduced to three (i.e., gag, pol, and rev).
- The VSV-G gene from Vesicular Stomatitis Virus is used in place of the HIV-1 envelope (Burns et al., 1993; Emi et al., 1991; Yee et al., 1994).
- Genes encoding the structural and viral genome packaging components are separated onto four plasmids. All four plasmids have been engineered not to contain any regions of homology with each other to prevent undesirable recombination events that could lead to the generation of a replication competent virus (Dull et al., 1998).
- Although the three packaging plasmids allow expression in trans of proteins required to produce viral progeny (e.g., gal, pol, rev, env) in the 293FT producer cell line, none of them contain LTRs or the ? packaging sequence. This means that none of the HIV-1 structural genes are actually present in the packaged viral genome, and thus, are never expressed in the transduced target cell. No new replication-competent virus can be produced.
- The lentiviral particles produced in this system are replication-incompetent and only carry the gene of interest. No other viral species are produced.
- Expression of the gag and pol genes from pLP1 has been rendered Rev dependent by virtue of the HIV-1 RRE in the gag/pol mRNA transcript. Addition of the RRE prevents gag and pol expression in the absence of Rev (Dull et al., 1998).
- A constitutive promoter (RSV promoter) has been placed upstream of the 5' LTR in the pLenti6/BLOCK-iT-DEST expression vector to offset the requirement for Tat in the efficient production of viral RNA (Dull et al., 1998).

Despite the inclusion of the safety features discussed on the previous page, the lentivirus produced with this system can still pose some biohazard risks since it can transduce primary human cells. For this reason, we highly recommend that you treat lentiviral stocks generated using this system as Biosafety Level 2 (BL-2) organisms and strictly follow all published BL-2 guidelines with proper waste decontamination. Furthermore, exercise extra caution when creating lentiviruses carrying potential harmful or toxic genes (e.g., activated oncogenes). For more information about the BL-2 guidelines and lentivirus handling, refer to the document “Biosafety in Microbiological and Biomedical Laboratories,”.

With regard to the promoter, H1 and U6, for the BLOCK-iT Lentiviral RNAi Expression System, is there a difference in knockdown?

Constitutive knockdown is virtually identical for these two promoters in HEK 293 cells. In other cell types there are reports that either H1 or U6 may be more active, though in general, differences are minimal.

What are the advantages of the BLOCK-iT Lentiviral RNAi expression system?

Use of the BLOCK-iT Lentiviral RNAi Expression System to facilitate lentiviral based delivery of shRNA to mammalian cells provides the following advantages:

- The pENTR/U6 entry vector provides a rapid and efficient way to clone ds oligo duplexes encoding a desired shRNA target sequence into a vector containing an RNA Pol III-dependent expression cassette (i.e., U6 RNAi cassette) for use in RNAi analysis.
- The vectors in the System are Gateway-adapted for easy recombination of the U6 RNAi cassette from the pENTR/U6 vector into the pLenti6/BLOCK-iT-DEST vector.
- Generates a replication-incompetent lentivirus that effectively transduces both dividing and nondividing mammalian cells, thus broadening the potential RNAi applications beyond those of other traditional retroviral systems (Naldini, 1998).
- Efficiently delivers the shRNA of interest to mammalian cells in culture or in vivo.
- Provides stable, long-term expression of the shRNA of interest beyond that offered by traditional adenovirus-based systems.
- Produces a pseudotyped virus with a broadened host range (Yee, 1999).
- Includes multiple features designed to enhance the biosafety of the system.

What does cytopathic effect mean?

Adenovirus is not an actively lytic virus, meaning that mature viral particles accumulate in the cell over the course of two to three days. As virus accumulates, the producer cell rounds up and eventually bursts due to the sheer number of virus particles inside. Once this occurs, neighboring cells become infected and the three-day cycle begins again. The term “cytopathic effect”, or CPE, is used to describe this and is typically visible within approximately 7 days posttransfection in the form of “comet-shaped” plaques resulting from two rounds of infection, replication and cell burst.

After 7 days, CPE will expand and eventually take over the plate by approximately 10 days posttransfection.
10 days are required to produce virus from a transfected dish of cells (as just described).
Once an initial viral stock is produced, it can be amplified directly by infection of fresh 293A cells at a multiplicity of infection (MOI) of 3.

What is the difference between infection and transduction?

Please see the definitions below:

Infection: Applies to situations where viral replication occurs and infectious viral progeny are generated. Only cell lines that stably express E1 can be infected.
Transduction: Applies to situations where no viral replication occurs and no infectious viral progeny are generated. Mammalian cell lines that do not express E1 are transduced. In this case, you are using adenovirus as a vehicle to deliver shRNA.

What are the general steps in creating an RNAi viral system?

Please see the steps below:

Clone the double-stranded DNA oligo encoding an shRNA or miR RNAi into one of the BLOCK-iT entry (shRNA) or expression (miR RNAi) vectors.
Transfer the RNAi cassette into the adenoviral (shRNA only) or lentiviral destination vector by Gateway recombination.
Transfect RNAi vectors into the viral producer cells to produce viral stocks, which can be used immediately or stored at -80 degrees C.
Harvest viral supernatants and determine the titer (amplify adenoviral stocks if desired).
Transduce lentiviral or adenoviral stocks to any cell type.


For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.