Learn More
Thermo Scientific™ SP6 promoter Sequencing Primer, 24-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO117
Additional Details : Weight : 0.00630kg
Description
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T7 promoter Sequencing Primer, 20-mer (SO118)
T3 promoter Sequencing Primer, 17-mer (SO119)
T3 promoter Sequencing Primer, 24-mer (SO120)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated
Specifications
SP6, T3, T7 | |
SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL) Store at –20°C. |
|
10 μM | |
42 μL | |
Sequencing |
Sequencing Primer | |
Dry Ice | |
SP6 | |
pTZ19R, pTZ57R, pBluescript II | |
Liquid |
For Research Use Only. Not for use in diagnostic procedures.