
Invitrogen™ Random Primers

Truly random primers suitable for DNA synthesis using Klenow fragments with DNA templates or for cDNA synthesis using reverse transcriptase with mRNA templates RANDOM PRIMERS,1.5MM 9 units

Invitrogen™ Random Decamers (50μM)

Provided at a stock concentration of 50μM, and functionally tested using the RETROscript™ Kit 80 UL RANDOM DECAMERS (50 UM) 80µL STORE AT -20 C

Thermo Scientific™ Oligo(dT)18 Primers

Thermo Scientific™ Oligo(dT)18 Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. 60 UL OLIGO(DT)18 PRIMER, 100µM 60µL STORE AT-20°C

Applied Biosystems™ Random Hexamers (50mM)

Serve as primers for DNA synthesis by a DNA polymerase or reverse transcriptase 1 SET Random Hexamers (50um) 1kit Store at -20 C

Invitrogen™ M13 Reverse

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13 REVERSE

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 18-MER 10UM 5.6 NMOL

Thermo Scientific™ M13/pUC sequencing primer (-20), 17-mer

Accurately sequence DNA with M13 pUC sequencing primers, single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. 6 NMOL M13/PUC SEQUENCING PRIMER (-20), 17-MER,5'-d(GTAAAACGACGGCCAGT)-3', 10µm, 6nmol Store at

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 17-MER 10UM 6NMOL

Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 FORWARD SEQUENCING PRIMER, 23-MER, 5'-D(CGACTCACTATAGGGAGAGCGGC)-3, 10µm, 8.7nmol Store at

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 24-MER 10UM 4.2NMOL

Invitrogen™ Bio-11-UTP (75mM)

Ideal for use as substrates as part of in vitro transcription reactions 30 UL BIO-11-UTP 30µL STORE AT -80°C

Invitrogen™ Oligo (dT) Primer (50mM)

Provided at a stock concentration of 50μM 80 UL OLIGO (DT) PRIMER (50 UM) 80µL STORE AT-20°C

Thermo Scientific™ Primers for cDNA Synthesis

Optimze cDNA synthesis with these random hexamer primers, oligo(dT)18 primers and anchored oligo dT primers. 120 UL RANDOM HEXAMER PRIMER, 100µM 120µL STOREat -20°C

Invitrogen™ 5-(3-Aminoallyl)-dUTP (50mM)

When incorporated into DNA, 5-(3-aminoallyl)-dUTP provides a reactive group for addition of other chemical groups 50MM 5-(3-AMINOALLYL)-UTP 5ULAmbion® Modified nucleotides confer unique

Thermo Scientific™ M13/pUC sequencing primer (-46), 22-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC PRIM -46 10UM 4.5NMOL

Thermo Scientific™ M13/pUC reverse sequencing primer (-46), 24-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC REV -46 10UM 4.2NMOL

Invitrogen™ RNA Century™-Plus Marker Templates

Contain mixtures of linearized plasmids ready for use as templates during in vitro transcription reactions for synthesis of labeled RNA molecular size standards 5 UG CENTURY-PLUS MARKER TEMPLATES 5µG STORE AT-20 C

Invitrogen™ Bio-16-UTP (10mM)

Ideal for use as substrates as part of in vitro transcription reactions 25 UL BIO-16-UTP 25µL STORE AT -80°C

Invitrogen™ Lambda Hind III dsDNA Markers

Ambion Lambda DNA is digested to completion with Hind III 0.5 MG LAMBDA DNA - HIND III DIGESTED 0.5MG STOREat -20°C

Invitrogen™ M13 Forward (-20)

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13(-20)FORWARD

Thermo Scientific™ Exo-Resistant Random Primer

Perform highly efficient random priming of DNA synthesis reactions with this mixture of single-stranded random oligonucleotides. 100 UL EXO-RESISTANT RANDOM PRIMER, 5'-NPNPNPNPNPSNpSN-3', 500µm 100µL Store at -20°C

Invitrogen™ T7 Promoter Primer

Primers for PCR amplification that complement many vectors PRIMER, T7Invitrogen offers primers for PCR amplification

Invitrogen™ Oligo(dT) 12-18 Primer

Primer is suitable for use in first-strand cDNA synthesis with reverse transcriptase Oligo(dT)12 18 Primer, 25 µg

Applied Biosystems™ Oligo d(T) 16 (50mM)

Used for priming and reverse transcription of polyadenylated (poly A+) mRNA OLIGO D(T)16 PRIMERApplied Biosystems® Oligo d(T)16 is a

Thermo Scientific™ M13/pUC sequencing primer (-40), 17-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at

Invitrogen™ pUC19 DNA (Sau3A I digested)

Ambion pUC 19 DNA is digested to completion with Sau3A I 0.5 MG PUC19 DNA - SAU3A I DIGESTED 0.5MG STOREat -20 C

Invitrogen™ Oligo(dT) 20 Primer

Used for first-strand cDNA synthesis with reverse transcriptase at temperatures of ≥50°C OLIGO DT(20) PRIMER

Invitrogen™ Bio-11-UTP (10mM)

Ideal for use as substrates as part of in vitro transcription reactions 25 UL BIO-11-UTP 25µL STORE AT -80°C

Applied Biosystems™ 5' Fluorescent Labeled Single Primers

Custom 5' labeled primers are fluorescently labeled oligos with a choice of dye on the 5' end TA PCRII DUAL PROMOTER

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 PRIMER 20-MER 10UM 5NMOL
